haleygudmundson haleygudmundson

02-04-2020
Mathematics

contestada

if you take my age and divide it by any off number greater than 1 and less than 9 you will get a remainder of 1

Respuesta :

monter445 monter445

02-04-2020

Answer:

no???

Step-by-step explanation:

Answer Link

Otras preguntas

please help me if you can, thank you!

What is the value of x? x = 2 x = 3 x = 4 x = 6

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

the height h in feet of a projectile launched upward at a speed of 32 feet/ second from a height of 48 feet is given by the function : h(t) =16^2+32t +48. how l

What is the distance between points (21, -32) and (-3, -25)?

Write a scientific explanation to describe the impact of the infected papaya trees on the toucan population.

HELP ASAP!! Which United States' president, in addition to Eisenhower, believed the federal government should play a smaller role in the economy? A) Ford B) Ca

100 points to whoever answers this question!! Five countries are competing in the high jump at the Olympics. Each country reached a certain height (in meters) f

What is the scale factor in the dilation? A) 2/5 B) 1/2 C) 2 D) 2 and 1/2

What body systems are used to pick up a pencil and write down a few sentences in the space below? Fingers, Hand and arms is not what I’m looking for.