Seudónimo Seudónimo
  • 04-04-2020
  • Mathematics
contestada

is (0,0) a solution of the graphed inequality?

is 00 a solution of the graphed inequality class=

Respuesta :

0dds5 0dds5
  • 04-04-2020
No because it is not within the shaded area
Answer Link
10211180 10211180
  • 04-04-2020

Answer:

No

Step-by-step explanation:

Answer Link

Otras preguntas

PLEASE HELP ASAP what is the correct product of (7x - 3)(7x + 3).49x^2 + 949x^2 - 42x + 9 49x^2 - 949x^2 + 42x + 9
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Joan is 5 years older than ellen, and 3 years ago the sum of their ages was 17 years. in how many years will joan be 21 years old?
Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D.
Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61
Explain how an enlargement or a reduction in the dimensions of a building would cause a change in the scale factor.
Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D.
What is the density of a liquid that has a volume of 20.0 ml and a mass of 330 grams?
What is the value of x? x = 2 x = 3 x = 4 x = 6
how was the 20th maine regiment so instrumental in winning the Battle of Gettysburg?