yaboy88 yaboy88
  • 04-05-2020
  • Chemistry
contestada

23
How many moles are in 500g of Calcium Nitrate? 10 M

Respuesta :

violettestroble22
violettestroble22 violettestroble22
  • 04-05-2020
500 grams Calcium Nitrate to mol= 3.04715
Answer Link

Otras preguntas

Please help- select all irrational numbers
(3,-2) and (7,6)Find the distance between the two points rounding to the nearest tenth
F(x) is shifted left 5 and shifted up 2 to create g(x). write the equation g(x).
Solve for x 2(x + 7) <3(x + 4)
In details, expatiate on why scarcity is a problem in economics​
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
PLEASE HELP!!!! I really need help​
A race car driver pulls onto a circular track. After 10 seconds, his speed is 200 km/h. The car travels at a steady speed of 200 km/h for 100 seconds and then s
the silver idol character sketch of 5 major characters​
to print a square of star shaoe we use the following code: A. cout<<“****”; B. cout<<“****\n”; C. cout<<****;