jose3661 jose3661

03-06-2020
English

contestada

Why doesn’t curleys wife like talking to her husband ?

Respuesta :

saanvidhadesugur saanvidhadesugur

03-06-2020

Answer:

Curley's wife doesn't like talking to him because she doesn't love him and he just complains about the other people working on the ranch and he always talking about how he is going to everybody the one two.

Explanation:

Answer Link

Otras preguntas

|x−12| =4 please help and show steps I have this due today!

Juarez Builders incurred $285,000 of labor costs for construction jobs completed during the month of August, of which $212,000 was direct and $73,000 was indire

What is the area of a circle that has a radius of 5 meters

Determine whether the random variable is discrete or continuous. In each case, state the possible values of the random variable. (a) The number of points scor

How many representatives are there in the U.S. House of Representatives ( Lower House)?

3. What kept many inner city African Americans poor?

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

In 1939, British and French leaders realized they could no longer ignore Axis aggressions. What is one of the first actions taken by Prime minister Chamberlain

What is 10 2/3 as a proper fraction?

Do 3/5 and 9/15 equal the same Whole?