shaywon shaywon
  • 01-09-2020
  • Mathematics
contestada

(4/5-715) +15=
Hurry

Respuesta :

gracieasummers
gracieasummers gracieasummers
  • 01-09-2020

Answer:

-699.2

Step-by-step explanation:

Answer Link
gabrielaherrerakj123 gabrielaherrerakj123
  • 01-09-2020
Exact form: -3496/5
Decimal form: -699.2
Mixed Number form: -6991/5
Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Cual es la relación entre fuerza masa y acceleration
what elements made up the compound carbon dioxide?​
which statement is true about provider information on the chronic condition verification form?
Salmon often jump waterfalls to reach their breeding grounds. Starting downstream, 3.17 m away from a waterfall 0.432 m in height, at what minimum speed must a
Find the polynomial that models the problem and use it to estimate the quantity. 1. A rectangle has a perimeter of 8x2+7x3+6x+7 and a length of x. Find the widt
I'll gib u brainliest if its correct!!!!1 and 5 star and thanks pls
Fill in the following sentence with the appropriate verb form. Montse ____ la Puerta de Casa
Connotativo de miedo y paz
I'LL GIVE A BRAINLIEST find the three inequalities that define the unshaded region, R​