jenna5358 jenna5358

03-10-2020
Mathematics

contestada

x=x property of equality

Respuesta :

Аноним Аноним

03-10-2020

Answer:

Reflexive Property

Step-by-step explanation:

For all real numbers x , x=x . A number equals itself

Answer Link

Otras preguntas

-4, determineGiven the equations of two lines to be -3x - y = 6 and ythe following:Find the slope and y-intercept of the line - 3x - y = 6. Enter the y-intercep

The function fx) = 110(1.004)* models the population of rabbits, inthousands, in a state x years after 1990. What is the approximatepopulation of the rabbits in

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

An object with a mass of 0.255 kg and density of 2.89 g/cm3 measures 34 mm in length and 46 mm in width. What is the height of the object?

3) Given the diagram below, if ZOMN = MNO, what must be true? I need help

263747_+'('-+'++'+58"-

Describe how this idea influences beners lee work today. Use two details from the text to support your answer ( MUST READ THE TEXT )

The figure below shows a circular lawn. It’s diameter is 72 ft.a.Use 3.14 for n in your calculations,and do not round your answer.Make sure to include the corre

find the slope of the line

АBThe scale factor that takes A onto B isThe scale factor that takes B onto A is