23mathiastrinidad
23mathiastrinidad 23mathiastrinidad
  • 03-03-2022
  • English
contestada

Write a short poem based on the poem "If we must die"

Write a short poem based on the poem If we must die class=

Respuesta :

IannaB
IannaB IannaB
  • 09-03-2022

Gray skies

no one to rely

forever rain

i shall never see a soul again

but that also means

no bullies

no discrimination

no littering

no war

but there'd still be no one to tell the story or tell it to

boo hoo

Answer Link

Otras preguntas

What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
in what area of Europe were the majority of warsaw pact countries
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
Why did the french revolution happen and who's fault was it
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
Give a recursive algorithm for finding the sum of the first n odd positive integers.
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?