qball1283 qball1283

02-05-2022
History

contestada

How did the continuation of the Cold War in the 1960s and 70s affect people in the United
States?

Respuesta :

jcobb443 jcobb443

03-05-2022

The intensive indoctrination of the American people led to a regression of social reforms.

Hope this helps :)

Answer Link

Otras preguntas

Katy invests a total of $26,500 in two accounts paying 4% and 9% annual interest, respectively. How much was invested in each account if, after one year, the to

What is [tex] \frac{1}{x+2} +\frac{6}{x-5} [/tex] equal to?Please show most of your work!!!Thank you!!

-( x + 4 ) = 2x + 35

Pete slid a domino off a bridge and it took 2.3 seconds to hit the Gully below how many feet did the domino fall

One year ago liz was three times as old as her brother jack. in two years she'll be only twice as old as jack. how old are liz and jack now?

Throughout most of the war, southern forces suffered from a chronic shortage of food and supplies. a. True b. False

what played a great role in the kansan nebraska act

There is no universally agreed-upon definition of cultural competence.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Access to valuable ______ may be playing a role in papua new guinea's struggle against islands that want to secede from that nation.