BrainlyHelper1
BrainlyHelper1 BrainlyHelper1
  • 03-11-2017
  • Mathematics
contestada

What is the slope of the line?

A. 0

B. 5

C. 11

D. Undefined

What is the slope of the line A 0 B 5 C 11 D Undefined class=

Respuesta :

Kylie10101
Kylie10101 Kylie10101
  • 05-11-2017
It’s D because all vertical lines have a slope that is undefined.
Answer Link
htxraquel htxraquel
  • 06-11-2017
The right answer is D. Undefined I got a 100% on the test so its the right answer 
Answer Link

Otras preguntas

does a human body use neon???
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
what are the 2 major types of cofactors?
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?